Browsing by Title
Now showing items 17746-17765 of 23978
-
Pulsed short wave therapy : its clinical use and physiological effects in healthy subjects and osteoarthritic patients
(University of Hertfordshire, 2004)PSWT is a commonly used electrotherapy modality and surveys have shown it to be one of the most widely used modalities among physiotherapists in the UK. Nevertheless, the literature supporting its therapeutic effects and ... -
A Purchase Protocol with Live Cardholder Authentication for Online Credit Card Payment
(Institute of Electrical and Electronics Engineers (IEEE), 2008) -
A Purchase Protocol with Multichannel Authentication
(2009)While online shopping are becoming more accepted by people in modern life, cardholders are more concerned about card fraud and the lack of cardholder authentication in the current online credit card payment. This paper ... -
Purchasing Intentions and Behaviour in China: a Comparison of Chinese Consumers in Key Cities - Beijing, Shanghai, Guangzhou and Chongqing
(2012-01-11)This research is a study of purchasing intentions and behaviors in China. Consumers from four key cities including Beijing, Shanghai, Chongqing, and Guangzhou were studied and differences in intentions and behavior as well ... -
The purification of poly(a)-containing RNA by affinity chromatography
(Springer Nature, 1985)The vast majority of eukaryotic mRNA molecules contain tracts of poly(adenylic) acid, up to 250 bases in length, at the 3' end. This property is very useful from the point of view of mRNA extraction because it forms the ... -
Purification of RNA
(Wiley-Blackwell, 1992) -
Purification, characterisation and identification of acidocin LCHV, an antimicrobial peptide produced by Lactobacillus acidophilus n.v. Er 317/402 strain Narine
(2010)In the last two decades, antimicrobial peptides (AMPs) have been gaining attention as antimicrobial alternatives to chemical food preservatives and commonly used antibiotics. Lactobacillus acidophilus n.v. Er 317/402 strain ... -
Purinergic 2X receptors mediate endothelial dependent vasodilation to ATP
(2007-11)ATP is an important endogenous mediator in the cardiovascular system. It induces endothelium dependent vasodilation, but the precise receptor pathway activated in this response is currently under debate. We have used ... -
Purinergic contribution to small intestinal afferent hypersensitivity in a murine model of post infectious bowel disease.
(2009-06)Increased sensitivity of the afferent innervation of the gastrointestinal tract reportedly underlies symptoms of discomfort and pain in functional bowel disorders. The present investigation aimed to examine whether the ... -
Puritanism and Truthfulness in Iris Murdoch's Ethics
(Tennessee University Press, 2014-11)In what follows I want to suggest, and to some extent argue, that Iris Murdoch’s understanding of puritanism is central to her ethic and that it constrains, or gives shape to, her account of truthfulness. But this does not ... -
Purple dwarfs : New L subdwarfs from UKIDSS and SDSS
(EDP Sciences, 2013)The first L subdwarf was a discovered only ten years ago. Less than ten L subdwarfs been published in the literature to date. Metal-poor ultracool atmospheres has not been well understood. Halo mass function cross substellar ... -
A Purple Passion? : Queen's College Oxford and the Blood of the Lord
(2012)The Queen’s College Oxford was founded in 1341 ‘under the name of the Hall of the Queen’s scholars of Oxford’ by the endowment of Robert de Eglesfield. The queen in question was Queen Philippa of Hainault, consort of King ... -
The pursuit of relevance in interaction and networks research
(University of Bath, 2000)The paper investigates the perceptions of researchers working in interaction and networks research concerning the relevance of academic research in the field to practical management decision-making. Managerial relevance ... -
Pushforwards via scattering equations with applications to positive geometries
(2022-10-03)In this paper we explore and expand the connection between two modern descriptions of scattering amplitudes, the CHY formalism and the framework of positive geometries, facilitated by the scattering equations. For theories ... -
Pushing the limits: palynological investigations at the margin of the Greenland Ice Sheet in the Norse Western Settlement
(2019-10-17)This paper presents two high-resolution pollen records dating to ~AD 1000-1400 that reveal the impacts of Norse colonists on vegetation and landscape around a remote farmstead in the Western Settlement of Greenland. The ... -
‘Put on your boots and Harrington!’: The ordinariness of 1970s UK punk dress
(2018-06-01)In 2013, the Metropolitan Museum hosted an exhibition of punk-inspired fashion entitled Punk: Chaos to Couture. The exhibition emphasized the ‘spectacular’ elements of the subculture, reflecting a narrative that dominates ... -
Putative DNA quadruplex formation within the human c-kit oncogene
(2005)The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence ... -
Putting apes, (body and language) together again
(2003)It is argued that the account of Savage-Rumbaugh's ape language research in Savage-Rumbaugh, Shanker and Taylor (1998. Apes, Language and the Human Mind. Oxford University Press, Oxford) is profitably read in the terms of ... -
Putting pupils at the heart of assessment. Children’s rights in practice.
(2008)This poster presents the outcomes of the TLRP project Consulting Pupils on the Assessment of their Learning. This project examined pupils’ participation in their own assessment from a children’s rights perspective. It ...