Browsing by Author "Reszka, Anthony P."

Now showing items 1-2 of 2

    • Putative DNA quadruplex formation within the human c-kit oncogene 

      Rankin, Sarah; Reszka, Anthony P.; Huppert, Julian; Zloh, Mire; Parkinson, Gary N.; Todd, Alan K.; Ladame, Sylvain; Balasubramanian, Shankar; Neidle, Stephen (2005)
      The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence ...

    • Sequences in the HSP90 promoter form G-quadruplex structures with selectivity for disubstituted phenyl bis-oxazole derivatives 

      Ohnmacht, Stephan A.; Micco, Marialuisa; Petrucci, Vanessa; Todd, Alan K.; Reszka, Anthony P.; Gunaratnam, Mekala; Carvalho, Marta A.; Zloh, Mire; Neidle, Stephen (2012)
      The HSP90 protein is an important target in cancer. We report here that stable quadruplex DNAs can be formed from a promoter sequence in the HSP90 gene, on the basis of melting, circular and NMR studies, and show that these ...