- UHRA Home
- Browsing by Author
Browsing by Author "Wei, Dengguo"
Now showing items 1-1 of 1
-
Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex
Wei, Dengguo; Todd, Alan K.; Zloh, Mire; Gunaratnam, Mekala; Parkinson, Gary N.; Neidle, Stephen (2013-12-26)The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive ...