Browsing University of Hertfordshire by Title
Now showing items 16220-16239 of 21975
-
The purification of poly(a)-containing RNA by affinity chromatography
(Humana Press / Springer, 1985)The vast majority of eukaryotic mRNA molecules contain tracts of poly(adenylic) acid, up to 250 bases in length, at the 3' end. This property is very useful from the point of view of mRNA extraction because it forms the ... -
Purification of RNA
(Wiley Blackwell, 1992) -
Purification, characterisation and identification of acidocin LCHV, an antimicrobial peptide produced by Lactobacillus acidophilus n.v. Er 317/402 strain Narine
(2010)In the last two decades, antimicrobial peptides (AMPs) have been gaining attention as antimicrobial alternatives to chemical food preservatives and commonly used antibiotics. Lactobacillus acidophilus n.v. Er 317/402 strain ... -
Purinergic 2X receptors mediate endothelial dependent vasodilation to ATP
(2007-11)ATP is an important endogenous mediator in the cardiovascular system. It induces endothelium dependent vasodilation, but the precise receptor pathway activated in this response is currently under debate. We have used ... -
Purinergic contribution to small intestinal afferent hypersensitivity in a murine model of post infectious bowel disease.
(2009-06)Increased sensitivity of the afferent innervation of the gastrointestinal tract reportedly underlies symptoms of discomfort and pain in functional bowel disorders. The present investigation aimed to examine whether the ... -
Puritanism and Truthfulness in Iris Murdoch's Ethics
(Tennessee University Press, 2014-11)In what follows I want to suggest, and to some extent argue, that Iris Murdoch’s understanding of puritanism is central to her ethic and that it constrains, or gives shape to, her account of truthfulness. But this does not ... -
Purple dwarfs : New L subdwarfs from UKIDSS and SDSS
(EDP Sciences, 2013)The first L subdwarf was a discovered only ten years ago. Less than ten L subdwarfs been published in the literature to date. Metal-poor ultracool atmospheres has not been well understood. Halo mass function cross substellar ... -
A Purple Passion? : Queen's College Oxford and the Blood of the Lord
(2012)The Queen’s College Oxford was founded in 1341 ‘under the name of the Hall of the Queen’s scholars of Oxford’ by the endowment of Robert de Eglesfield. The queen in question was Queen Philippa of Hainault, consort of King ... -
The pursuit of relevance in interaction and networks research
(University of Bath, 2000)The paper investigates the perceptions of researchers working in interaction and networks research concerning the relevance of academic research in the field to practical management decision-making. Managerial relevance ... -
Pushing the limits: palynological investigations at the margin of the Greenland Ice Sheet in the Norse Western Settlement
(2019-10-17)This paper presents two high-resolution pollen records dating to ~AD 1000-1400 that reveal the impacts of Norse colonists on vegetation and landscape around a remote farmstead in the Western Settlement of Greenland. The ... -
‘Put on your boots and Harrington!’: The ordinariness of 1970s UK punk dress
(2018-06-01)In 2013, the Metropolitan Museum hosted an exhibition of punk-inspired fashion entitled Punk: Chaos to Couture. The exhibition emphasized the ‘spectacular’ elements of the subculture, reflecting a narrative that dominates ... -
Putative DNA quadruplex formation within the human c-kit oncogene
(2005)The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence ... -
Putting apes, (body and language) together again
(2003)It is argued that the account of Savage-Rumbaugh's ape language research in Savage-Rumbaugh, Shanker and Taylor (1998. Apes, Language and the Human Mind. Oxford University Press, Oxford) is profitably read in the terms of ... -
Putting pupils at the heart of assessment. Children’s rights in practice.
(2008)This poster presents the outcomes of the TLRP project Consulting Pupils on the Assessment of their Learning. This project examined pupils’ participation in their own assessment from a children’s rights perspective. It ... -
Putting research first? Perspectives from academics and students on first-year undergraduates learning research
(2019-03-11)Exploring the place and potential of ‘research’ in undergraduate degrees has stimulated higher-educational debate for decades, strongly influencing policies, practices and structures. This article’s consideration of some ... -
Pyrosequencing the transcriptome of the greenhouse whitefly, Trialeurodes vaporariorum reveals multiple transcripts encoding insecticide targets and detoxifying enzymes
(2011-01-24)Background: The whitefly Trialeurodes vaporariorum is an economically important crop pest in temperate regions that has developed resistance to most classes of insecticides. However, the molecular mechanisms underlying ... -
q-Deformed Supersymmetry and Dynamic Magnon Representations
(2007-04-17)It was recently noted that the dispersion relation for the magnons of planar N=4 SYM can be identified with the Casimir of a certain deformation of the Poincare algebra, in which the energy and momentum operators are ... -
Qatar Interprofessional Health Council
(2012-01)The QIHC was formed in September 2009 by a small group of representatives from health care education and delivery institutions in Qatar who shared a common desire for the delivery of high quality interprofessional health ... -
Qatar welcomes the Extracorporeal Life Support Organisation South and West Asia Chapter 2017 Conference
(2017-02-14)Extracorporeal Life Support (ECLS) is saving an increasing number of lives worldwide, 1 so it is a great pleasure to welcome for the first time in Qatar the South and West Asia Chapter (SWAC) of the Extracorporeal Life ...