Search
Now showing items 1-10 of 1072
Porous Market Hall, Ghent
(2013-12-31)
Recognizing facial expressions : Computational models and humans
(Institute of Electrical and Electronics Engineers (IEEE), 2013-12-31)
This paper discusses various biologically plausible computational models that recognize human facial expression and analyze them. Identifying facial expressions is a non trivial task for a human and is a key part of social ...
Epigenetic adaptation through hormone modulation in autonomous robots
(Institute of Electrical and Electronics Engineers (IEEE), 2013-12-31)
Epigenetic adaptation provides biological organisms with the ability to adjust their physiology and/or morphology in order to meet some of the challenges posed by their environment. Recent research has suggested that this ...
Group Supervision: An introduction to annual reviews in Midwifery Supervision
(2013-12-30)
This article describes the implementation of group supervision at a large maternity unit in London and its subsequent evaluation from the midwives who participated. In October 2011, following a Care Quality Commission (CQC) ...
Self-organized cooperative 5G RANs with intelligent optical backhauls for mobile cloud computing
(Institute of Electrical and Electronics Engineers (IEEE), 2013-12-27)
In the near future, it is expected that mobile cloud computing (MCC) will benefit enterprises by improving network manageability and maintenance, as well as end users with respect to sharing computing resources. For this ...
Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex
(2013-12-26)
The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive ...
Massive stars in massive clusters - IV. Disruption of clouds by momentum-driven winds
(2013-12-21)
We examine the effect of momentum-driven OB-star stellar winds on a parameter space of simulated turbulent giant molecular clouds using smoothed particle hydrodynamic simulations. By comparison with identical simulations ...
A new CVD diamond mosaic-detector for (n, α) cross-section measurements at the n_TOF experiment at CERN
(2013-12-21)
At the n_TOF experiment at CERN a dedicated single-crystal chemical vapor deposition (sCVD) Diamond Mosaic-Detector has been developed for (n,α) cross-section measurements. The detector, characterized by an excellent time ...
Stability analysis of the MAAT feeder airship during ascent and descent with wind disturbances
(2013-12-19)
This paper looks into with the aerodynamic properties and stability of the feeder airship in the framework of MAAT project. FP7 MAAT project is based on the concept of two different types of airships (the cruiser and the ...