Browsing by Title
Now showing items 4357-4376 of 24090
-
Cross-sector surveys assessing perceptions of key stakeholders towards barriers, concerns and facilitators to the appropriate use of adaptive designs in confirmatory trials
(2015-12-23)Background Appropriately conducted adaptive designs (ADs) offer many potential advantages over conventional trials. They make better use of accruing data, potentially saving time, trial participants, and limited resources ... -
Cross-spectral properties of a spatial point-lattice process
(2008-12-15)This paper shows how spectral analysis can be used to study a hybrid process involving a spatial point process and a lattice process. Asymptotic distributions of spectral statistics for such processes are derived. -
Cross-talk between toll-like receptor 4 (TLR4) and proteinase-activated receptor 2 (PAR) is involved in vascular function
(2013)Background and Purpose Proteinase-activated receptors (PARs) and toll-like receptors (TLRs) are involved in innate immune responses. The aim of this study was to evaluate the possible cross-talk between PAR and TLR4 in ... -
A cross-taxonomic index for quantifying the health of farmland biodiversity
(2009-12)1. The development of sustainable, multi-functional agricultural systems involves reconciling the needs of agricultural production with the objectives for environmental protection, including biodiversity conservation. ... -
Crossing the Line : Millennium and Wallander On Screen and the Global Stage
(Palgrave Macmillan, 2013)Through a combination of socio-historical analysis and close criticism, the chapter explores the intersections between adaptations of Larsson and Mankell's written work, particularly in terms of their relationship to ... -
Crossmedia
(2011)In conjunction with The British Council, myself and Karrie Fransman were invited to co-curate an exhibition of experimental comics at the premiere Flemish comics festival in Turnhout. Working alongside cartoonists Douglas ... -
A cross‐sectional study of the prevalence and clinical management of atherosclerotic cardiovascular diseases in patients with type 2 diabetes across the Middle East and Africa ( PACT‐MEA ): Study design and rationale
(2023-03-03)Aim: To investigate the epidemiology and clinical management of patients with type 2 diabetes (T2D) and established atherosclerotic cardiovascular disease (eASCVD) or high/very high ASCVD risk, defined by the 2021 European ... -
Crowd Work in Europe : Preliminary results from a survey in the UK, Sweden, Germany, Austria and the Netherlands
(Foundation for European Progressive Studies, 2016-12-02) -
Crowded and sparse domains in object recognition: consequences for categorisation and naming
(2006)Some models of object recognition propose that items from structurally crowded categories (e.g., living things) permit faster access to superordinate semantic information than structurally dissimilar categories (e.g., ... -
Crowded Kitchens : the 'democratisation' of domesticity?
(2013-08)Building on previous work concerning the gendered nature of domestic space, this article focuses on the kitchen as a key site in which gendered roles and responsibilities are experienced and contested. As men have begun ... -
Crucial inputs to nucleosynthesis calculations
(2008-01)The first part of the paper discusses nuclear properties relevant to predict compound reactions. The second part addresses direct reactions with special emphasis on direct neutron capture. -
Crunch time for IAPT?
(2008-12-01) -
Cryotherapy or gradual reloading exercises in acute presentations of rotator cuff tendinopathy: a randomised controlled trial
(2018)Objectives Rotator cuff tendinopathies are the most common shoulder disorders. As persistent symptoms lasting more than 3 months have been shown to be a strong indicator of poor outcomes, it is important to have successful ... -
Cryptosphere : Mapping Paradise [Large modular sculptural system]
(Royal Geographical Society, 2008)Cryptosphere was an exhibition, residency, conference and publication based on my original research and artistic response to the map collection of the Royal Geographical Society, London. It was funded by the Leverhulme ... -
Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex
(2013-12-26)The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive ... -
Crystallographic tomography and molecular modelling of structured organic polycrystalline powders
(2021-03-02)A fundamental understanding of the behaviour of polycrystalline materials, including pharmaceuticals, is vital for control of their physicochemical and crystalline properties, which in turn has the potential to improve ... -
CSI 2264: Simultaneous optical and infrared light curves of young disk-bearing stars in NGC 2264 with CoRoT and Spitzer-- evidence for multiple origins of variability
(2014-03-13)We present the Coordinated Synoptic Investigation of NGC 2264, a continuous 30-day multi-wavelength photometric monitoring campaign on more than 1000 young cluster members using 16 telescopes. The unprecedented combination ... -
CSI at the bfi ...
(I.B. Tauris, 2007)