Putative DNA quadruplex formation within the human c-kit oncogene
Author
Rankin, Sarah
Reszka, Anthony P.
Huppert, Julian
Zloh, Mire
Parkinson, Gary N.
Todd, Alan K.
Ladame, Sylvain
Balasubramanian, Shankar
Neidle, Stephen
Attention
2299/10357
Abstract
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.