- UHRA Home
- Browsing by Author
Browsing by Author "Gunaratnam, Mekala"
Now showing items 1-2 of 2
-
Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex
Wei, Dengguo; Todd, Alan K.; Zloh, Mire; Gunaratnam, Mekala; Parkinson, Gary N.; Neidle, Stephen (2013-12-26)The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive ... -
Sequences in the HSP90 promoter form G-quadruplex structures with selectivity for disubstituted phenyl bis-oxazole derivatives
Ohnmacht, Stephan A.; Micco, Marialuisa; Petrucci, Vanessa; Todd, Alan K.; Reszka, Anthony P.; Gunaratnam, Mekala; Carvalho, Marta A.; Zloh, Mire; Neidle, Stephen (2012)The HSP90 protein is an important target in cancer. We report here that stable quadruplex DNAs can be formed from a promoter sequence in the HSP90 gene, on the basis of melting, circular and NMR studies, and show that these ...