Browsing by Author "Ladame, Sylvain"

Now showing items 1-1 of 1

    • Putative DNA quadruplex formation within the human c-kit oncogene 

      Rankin, Sarah; Reszka, Anthony P.; Huppert, Julian; Zloh, Mire; Parkinson, Gary N.; Todd, Alan K.; Ladame, Sylvain; Balasubramanian, Shankar; Neidle, Stephen (2005)
      The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence ...