- UHRA Home
- Browsing by Author
Browsing by Author "Parkinson, Gary N."
Now showing items 1-3 of 3
-
Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex
Wei, Dengguo; Todd, Alan K.; Zloh, Mire; Gunaratnam, Mekala; Parkinson, Gary N.; Neidle, Stephen (2013-12-26)The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive ... -
Putative DNA quadruplex formation within the human c-kit oncogene
Rankin, Sarah; Reszka, Anthony P.; Huppert, Julian; Zloh, Mire; Parkinson, Gary N.; Todd, Alan K.; Ladame, Sylvain; Balasubramanian, Shankar; Neidle, Stephen (2005)The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence ... -
Solution structure of a 2:1 C2-(2-naphthyl) pyrrolo[2,1-c][1,4]benzodiazepine DNA adduct : molecular basis for unexpectedly high DNA helix stabilization
Antonow, Dyeison; Barata, Teresa; Jenkins, Terence C.; Parkinson, Gary N.; Howard, Philip W.; Thurston, David E; Zloh, Mire (2008)The naturally occurring pyrrolo[2,1- c][1,4]benzodiazepine (PBD) monomers such as sibiromycin, anthramycin, and tomaymycin form stable covalent adducts with duplex DNA at purine-guanine-purine sites. A correlative relationship ...