Show simple item record

dc.contributor.authorRankin, Sarah
dc.contributor.authorReszka, Anthony P.
dc.contributor.authorHuppert, Julian
dc.contributor.authorZloh, Mire
dc.contributor.authorParkinson, Gary N.
dc.contributor.authorTodd, Alan K.
dc.contributor.authorLadame, Sylvain
dc.contributor.authorBalasubramanian, Shankar
dc.contributor.authorNeidle, Stephen
dc.date.accessioned2013-04-11T11:29:39Z
dc.date.available2013-04-11T11:29:39Z
dc.date.issued2005
dc.identifier.citationRankin , S , Reszka , A P , Huppert , J , Zloh , M , Parkinson , G N , Todd , A K , Ladame , S , Balasubramanian , S & Neidle , S 2005 , ' Putative DNA quadruplex formation within the human c-kit oncogene ' , Journal of the American Chemical Society , vol. 127 , no. 30 , pp. 10584-9 . https://doi.org/10.1021/ja050823u
dc.identifier.issn0002-7863
dc.identifier.urihttp://hdl.handle.net/2299/10357
dc.description.abstractThe DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.en
dc.format.extent6
dc.language.isoeng
dc.relation.ispartofJournal of the American Chemical Society
dc.titlePutative DNA quadruplex formation within the human c-kit oncogeneen
dc.contributor.institutionPsychopharmacology, Drug Misuse and Novel Psychoactive Substances Unit
dc.contributor.institutionCentre for Health Services and Clinical Research
dc.description.statusPeer reviewed
rioxxterms.versionofrecord10.1021/ja050823u
rioxxterms.typeJournal Article/Review
herts.preservation.rarelyaccessedtrue


Files in this item

FilesSizeFormatView

There are no files associated with this item.

This item appears in the following Collection(s)

Show simple item record