dc.contributor.author | Rankin, Sarah | |
dc.contributor.author | Reszka, Anthony P. | |
dc.contributor.author | Huppert, Julian | |
dc.contributor.author | Zloh, Mire | |
dc.contributor.author | Parkinson, Gary N. | |
dc.contributor.author | Todd, Alan K. | |
dc.contributor.author | Ladame, Sylvain | |
dc.contributor.author | Balasubramanian, Shankar | |
dc.contributor.author | Neidle, Stephen | |
dc.date.accessioned | 2013-04-11T11:29:39Z | |
dc.date.available | 2013-04-11T11:29:39Z | |
dc.date.issued | 2005 | |
dc.identifier.citation | Rankin , S , Reszka , A P , Huppert , J , Zloh , M , Parkinson , G N , Todd , A K , Ladame , S , Balasubramanian , S & Neidle , S 2005 , ' Putative DNA quadruplex formation within the human c-kit oncogene ' , Journal of the American Chemical Society , vol. 127 , no. 30 , pp. 10584-9 . https://doi.org/10.1021/ja050823u | |
dc.identifier.issn | 0002-7863 | |
dc.identifier.uri | http://hdl.handle.net/2299/10357 | |
dc.description.abstract | The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene. | en |
dc.format.extent | 6 | |
dc.language.iso | eng | |
dc.relation.ispartof | Journal of the American Chemical Society | |
dc.title | Putative DNA quadruplex formation within the human c-kit oncogene | en |
dc.contributor.institution | School of Life and Medical Sciences | |
dc.contributor.institution | Health & Human Sciences Research Institute | |
dc.contributor.institution | Department of Pharmacy | |
dc.contributor.institution | Medicinal and Analytical Chemistry | |
dc.description.status | Peer reviewed | |
rioxxterms.versionofrecord | 10.1021/ja050823u | |
rioxxterms.type | Journal Article/Review | |
herts.preservation.rarelyaccessed | true | |