- UHRA Home
- University of Hertfordshire
- Browsing University of Hertfordshire by Author
Browsing University of Hertfordshire by Author "Huppert, Julian"
Now showing items 1-1 of 1
-
Putative DNA quadruplex formation within the human c-kit oncogene
Rankin, Sarah; Reszka, Anthony P.; Huppert, Julian; Zloh, Mire; Parkinson, Gary N.; Todd, Alan K.; Ladame, Sylvain; Balasubramanian, Shankar; Neidle, Stephen (2005)The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence ...