Research publications: Recent submissions
Now showing items 5721-5740 of 9764
-
A comprehensive study of the Cd-106(alpha, gamma)Sn-110 reaction at energies relevant to the p-process
(2005-07-25)In order to test the reliability of reaction rate calculations in the framework of the Hauser-Feshbach statistical model, the cross sections of Cd-106(alpha,gamma)Sn-110 radiative capture reaction were determined in the ... -
Randomized controlled trial of specific spinal stabilization exercises and conventional physiotherapy for recurrent low back pain
(2006)Pragmatic, multicentered randomized controlled trial, with 12-month follow-up. -
The (n,gamma) cross sections of the p-process nuclei Se-74 and Sr-84 at kT=25 keV
(2005-07-25)The formation of the isotopes on the proton-rich side of the valley of stability cannot be ascribed to neutron capture reactions in the r- or s-processes. These nuclei are produced in the p process, which presumably takes ... -
Measurement and resonance analysis of the Np-237 neutron capture cross section
(2012-04-20)The neutron capture cross section of Np-237 was measured between 0.7 and 500 eV at the CERN n_TOF facility using the 4 pi BaF2 Total Absorption Calorimeter. The experimental capture yield was extracted minimizing all the ... -
Union Organizing and Membership Growth : Why Don't They Organize?
(2012)This study analyzes U.S. union organizing activity and membership growth from 1990-2004, a period in which an overall pattern of union decline continued and in which organizing achieved renewed prominence as both a union ... -
Population dynamics and dispersal of Leptosphaeria maculans (blackleg of canola)
(2005)Blackleg of canola (oilseed rape, Brassica napus) is caused by two closely related fungal species, Leptosphaeria maculans and L. biglobosa. In Australia, with a few rare exceptions, blackleg is caused by L. maculans, whereas ... -
Wheat archive links long-term fungal pathogen population dynamics to air pollution
(2005-04-12)We used the PCR to study the presence of two plant pathogens in archived wheat samples from a long-term experiment started in 1843. The data were used to construct a unique 160-yr time-series of the abundance of Phaeosphaeria ... -
Identification and characterization of polymorphic minisatellites in the phytopathogenic ascomycete Leptosphaeria maculans
(2005-01)Leptosphaeria maculans causes phoma stem canker, the most serious disease of oilseed rape world-wide. Sexual recombination is important in the pathogen life cycle and increases the risk of plant resistance genes being ... -
The changing epidemiology of Clostridium difficile infections
(2010)The epidemiology of Clostridium difficile infection (CDI) has changed dramatically during this millennium. Infection rates have increased markedly in most countries with detailed surveillance data. There have been clear ... -
Evaluation of linezolid for the treatment of Clostridium difficile infection caused by epidemic strains using an in vitro human gut model
(2011)Therapeutic options in Clostridium difficile infection (CDI) are limited. We examined linezolid activity in vitro and potential therapeutic efficacy using a gut model of CDI. -
The effects of polyvinyl alcohol on the in vitro stability and delivery of spray-dried protein particles from surfactant-free HFA 134a-based pressurised metered dose inhalers
(2005-11-04)The objective of the present study was to investigate the physical stability of spray-dried proteins within surfactant-free hydrofluoroalkane (HFA) pressurised metered dose inhalers (pMDIs) during prolonged storage. Two ... -
In vitro mutation and selection of doubled-haploid Brassica napus lines with improved resistance to Sclerotinia sclerotiorum
(2005-06)This paper describes a new protocol to develop doubled-haploid (DH) Brassica napus lines with improved resistance to Sclerotinia sclerotiorum. In this protocol, haploid seedlings derived from microspore cultures of B. napus ... -
Hyaluronic acid : a unique topical vehicle for the localized delivery of drugs to the skin
(2005-05)Hyaluronic acid (HA) is a naturally occurring polyanionic, polysaccharide that consists of N-acetyl-D-glucosamine and beta-glucoronic acid. It is present in the intercellular matrix of most vertebrate connective tissues ... -
Hyaluronan: Pharmaceutical characterization and drug delivery
(2005)Hyaluronic acid ( HA), is a polyanionic polysaccharide that consists of N-acetyl-D-glucosamine and beta-glucoronic acid. It is most frequently referred to as hyaluronan because it exists in vivo as a polyanion and not in ... -
Agrobacterium tumefaciens-mediated transformation of Leptosphaeria spp. and Oculimacula spp. with the reef coral gene DsRed and the jellyfish gene gfp
(2005-12-01)Four filamentous ascomycetes, Leptosphaeria maculans, L. biglobosa, Oculimacula yallundae and O. acuformis, were transformed via Agrobacterium tumefaciens-mediated transformation with the genes encoding DsRed and GFP. Using ... -
Advanced microscopy solutions for monitoring the kinetics and dynamics of drug-DNA targeting in living cells
(2005)Many anticancer drugs require interaction with DNA or chromatin components of tumor cells to achieve therapeutic activity. Quantification and exploration of drug targeting dynamics can be highly informative in the rational ... -
Putative DNA quadruplex formation within the human c-kit oncogene
(2005)The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence ... -
Development of Oculimacula yallundae and O-acuformis (eyespot) on leaf sheaths of winter wheat in the UK in relation to thermal time
(2005-04)In a controlled environment (15/10 degrees C) (day/night) container experiment on winter wheat (cv. Avalon), eyespot incidence (percentage of plants affected) and number of leaf sheaths penetrated after 6 weeks increased ... -
High-pressure aerosol suspensions : A novel laser diffraction particle sizing system for hydrofluoroalkane pressurised metered dose inhalers
(2005-09-30)In this study, a novel laser diffraction particle size analysis dispersion system, capable of sizing particles in situ within suspension hydrofluoroalkane (HFA) pressurised metered dose inhalers (pMDIs), was developed and ... -
Veterinary anthelmintics : old and new
(2004-10)Between 1960 and 1980, extraordinary success was achieved in anthelmintic development for animals. In these 20 years, drugs with diverse structure, novel activity and enviable safety were produced for a global livestock ...