Putative DNA quadruplex formation within the human c-kit oncogene

Rankin, Sarah, Reszka, Anthony P., Huppert, Julian, Zloh, Mire, Parkinson, Gary N., Todd, Alan K., Ladame, Sylvain, Balasubramanian, Shankar and Neidle, Stephen (2005) Putative DNA quadruplex formation within the human c-kit oncogene. Journal of the American Chemical Society (30). pp. 10584-9. ISSN 0002-7863
Copy

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Full text not available from this repository.

Atom BibTeX OpenURL ContextObject in Span OpenURL ContextObject Dublin Core MPEG-21 DIDL Data Cite XML EndNote HTML Citation METS MODS RIOXX2 XML Reference Manager Refer ASCII Citation
Export

Downloads