Now showing items 1-4 of 4

    • Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex 

      Wei, Dengguo; Todd, Alan K.; Zloh, Mire; Gunaratnam, Mekala; Parkinson, Gary N.; Neidle, Stephen (2013-12-26)
      The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive ...
    • Putative DNA quadruplex formation within the human c-kit oncogene 

      Rankin, Sarah; Reszka, Anthony P.; Huppert, Julian; Zloh, Mire; Parkinson, Gary N.; Todd, Alan K.; Ladame, Sylvain; Balasubramanian, Shankar; Neidle, Stephen (2005)
      The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence ...
    • Sequences in the HSP90 promoter form G-quadruplex structures with selectivity for disubstituted phenyl bis-oxazole derivatives 

      Ohnmacht, Stephan A.; Micco, Marialuisa; Petrucci, Vanessa; Todd, Alan K.; Reszka, Anthony P.; Gunaratnam, Mekala; Carvalho, Marta A.; Zloh, Mire; Neidle, Stephen (2012)
      The HSP90 protein is an important target in cancer. We report here that stable quadruplex DNAs can be formed from a promoter sequence in the HSP90 gene, on the basis of melting, circular and NMR studies, and show that these ...
    • Structure-activity relationships of monomeric C2-aryl pyrrolo[2,1-c][1,4]benzodiazepine (PBD) antitumor agents 

      Antonow, Dyeison; Kaliszczak, Maciej; Kang, Gyoung-Dong; Coffils, Marissa; Tiberghien, Arnaud C; Cooper, Nectaroula; Barata, Teresa; Heidelberger, Sibylle; James, Colin H; Zloh, Mire; Jenkins, Terence C; Reszka, Anthony P; Neidle, Stephen; Guichard, Sylvie M; Jodrell, Duncan I; Hartley, John A; Howard, Philip W; Thurston, David E (2010)
      A comprehensive SAR investigation of the C2-position of pyrrolo[2,1-c][1,4]benzodiazepine (PBD) monomer antitumor agents is reported, establishing the molecular requirements for optimal in vitro cytotoxicity and DNA-binding ...