Browsing Research publications by Title

Now showing items 16996-17015 of 22956

    • Puritanism and Truthfulness in Iris Murdoch's Ethics 

      Milligan, Tony (Tennessee University Press, 2014-11)
      In what follows I want to suggest, and to some extent argue, that Iris Murdoch’s understanding of puritanism is central to her ethic and that it constrains, or gives shape to, her account of truthfulness. But this does not ...

    • Purple dwarfs : New L subdwarfs from UKIDSS and SDSS 

      Zhang, Z. H.; Pinfield, D.J.; Burningham, B.; Jones, H.R.A.; Day-Jones, A. C.; Marocco, F.; Gomes, J.; Galvez-Ortiz, M. C. (EDP Sciences, 2013)
      The first L subdwarf was a discovered only ten years ago. Less than ten L subdwarfs been published in the literature to date. Metal-poor ultracool atmospheres has not been well understood. Halo mass function cross substellar ...

    • A Purple Passion? : Queen's College Oxford and the Blood of the Lord 

      Christianson, B. (2012)
      The Queen’s College Oxford was founded in 1341 ‘under the name of the Hall of the Queen’s scholars of Oxford’ by the endowment of Robert de Eglesfield. The queen in question was Queen Philippa of Hainault, consort of King ...

    • The pursuit of relevance in interaction and networks research 

      Brennan, Ross; Turnbull, P.W. (University of Bath, 2000)
      The paper investigates the perceptions of researchers working in interaction and networks research concerning the relevance of academic research in the field to practical management decision-making. Managerial relevance ...

    • Push for technology enhanced learning... with what you can afford 

      Alinier, Guillaume (2012-10-01)

    • Pushforwards via scattering equations with applications to positive geometries 

      Łukowski, Tomasz; Moerman, Robert; Stalknecht, Jonah (2022-10-03)
      In this paper we explore and expand the connection between two modern descriptions of scattering amplitudes, the CHY formalism and the framework of positive geometries, facilitated by the scattering equations. For theories ...

    • Pushing the limits: palynological investigations at the margin of the Greenland Ice Sheet in the Norse Western Settlement 

      Schofield, J.Edward; Pearce, Danni; Mair, Douglas; Rea, Brice R.; Lea, James; Kamenos, Nicholas; Schoenrock, Kathryn; Barr, Iestyn; Edwards, Kevin (2019-10-17)
      This paper presents two high-resolution pollen records dating to ~AD 1000-1400 that reveal the impacts of Norse colonists on vegetation and landscape around a remote farmstead in the Western Settlement of Greenland. The ...

    • ‘Put on your boots and Harrington!’: The ordinariness of 1970s UK punk dress 

      Weiner, Nathaniel (2018-06-01)
      In 2013, the Metropolitan Museum hosted an exhibition of punk-inspired fashion entitled Punk: Chaos to Couture. The exhibition emphasized the ‘spectacular’ elements of the subculture, reflecting a narrative that dominates ...

    • Putative DNA quadruplex formation within the human c-kit oncogene 

      Rankin, Sarah; Reszka, Anthony P.; Huppert, Julian; Zloh, Mire; Parkinson, Gary N.; Todd, Alan K.; Ladame, Sylvain; Balasubramanian, Shankar; Neidle, Stephen (2005)
      The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence ...

    • Putting apes, (body and language) together again 

      Cowley, S.; Spurrett, D. (2003)
      It is argued that the account of Savage-Rumbaugh's ape language research in Savage-Rumbaugh, Shanker and Taylor (1998. Apes, Language and the Human Mind. Oxford University Press, Oxford) is profitably read in the terms of ...

    • Putting pupils at the heart of assessment. Children’s rights in practice. 

      Leitch, R.; Lundy, L.; Clough, P.; Gardner, J.; Odena, O. (2008)
      This poster presents the outcomes of the TLRP project Consulting Pupils on the Assessment of their Learning. This project examined pupils’ participation in their own assessment from a children’s rights perspective. It ...

    • Putting research first? Perspectives from academics and students on first-year undergraduates learning research 

      Bage, Grant (2019-03-11)
      Exploring the place and potential of ‘research’ in undergraduate degrees has stimulated higher-educational debate for decades, strongly influencing policies, practices and structures. This article’s consideration of some ...

    • The puzzle of the formation of T8 dwarf Ross 458c 

      Gaarn, Josefine; Burningham, Ben; Faherty, Jacqueline K.; Visscher, Channon; Marley, Mark S.; Gonzales, Eileen C.; Calamari, Emily; Gagliuffi, Daniella Bardalez; Lupu, Roxana; Freedman, Richard (2023-06-01)
      At the lowest masses, the distinction between brown dwarfs and giant exoplanets is often blurred and literature classifications rarely reflect the deuterium burning boundary. Atmospheric characterization may reveal the ...

    • PyDTS: A Python Toolkit for Deep Learning Time Series Modelling 

      Schirmer, Pascal A.; Mporas, Iosif (2024-03-31)
      In this article, the topic of time series modelling is discussed. It highlights the criticality of analysing and forecasting time series data across various sectors, identifying five primary application areas: denoising, ...

    • Pyrosequencing the transcriptome of the greenhouse whitefly, Trialeurodes vaporariorum reveals multiple transcripts encoding insecticide targets and detoxifying enzymes 

      Karatolos, Nikos; Pauchet, Yannick; Wilkinson, Paul; Chauhan, Ritika; Denholm, Ian; Gorman, Kevin; Nelson, David R.; Bass, Chris; Ffrench-Constant, Richard H.; Williamson, Martin S. (2011-01-24)
      Background: The whitefly Trialeurodes vaporariorum is an economically important crop pest in temperate regions that has developed resistance to most classes of insecticides. However, the molecular mechanisms underlying ...

    • q-Deformed Supersymmetry and Dynamic Magnon Representations 

      Young, Charles A. S. (2007-04-17)
      It was recently noted that the dispersion relation for the magnons of planar N=4 SYM can be identified with the Casimir of a certain deformation of the Poincare algebra, in which the energy and momentum operators are ...

    • A Q-learning-based smart clustering routing method in flying Ad Hoc networks 

      Hosseinzadeh, Mehdi; Tanveer, Jawad; Rahmani, Amir Masoud; Yousefpoor, Efat; Aurangzeb, Khursheed; Yousefpoor, Mohammad Sadegh; Darwesh, Aso; Lee , Sang-Woong; Fazlali, Mahmood (2024-01)
      Flying ad hoc networks (FANETs) have particular importance in various military and civilian applications due to their specific features, including frequent topological changes, the movement of drones in a three-dimensional ...

    • Qatar Interprofessional Health Council 

      Pyburn, Renee; Alinier, Guillaume (2012-01)
      The QIHC was formed in September 2009 by a small group of representatives from health care education and delivery institutions in Qatar who shared a common desire for the delivery of high quality interprofessional health ...

    • Qatar welcomes the Extracorporeal Life Support Organisation South and West Asia Chapter 2017 Conference 

      Alinier, Guillaume; Campbell, Craig; Labib, Ahmed; Mehta, Tejas; Ait Hssain, Ali; Almomani, Emad; Fawzy Hassan, Ibrahim (2017-02-14)
      Extracorporeal Life Support (ECLS) is saving an increasing number of lives worldwide, 1 so it is a great pleasure to welcome for the first time in Qatar the South and West Asia Chapter (SWAC) of the Extracorporeal Life ...

    • QoS aware MAC protocol for OFDMA-PON 

      Lim, W.; Kourtessis, P.; Milosavljevic, M.; Senior, J.M. (Institute of Electrical and Electronics Engineers (IEEE), 2011)
      A quality of service (QoS) aware medium access control (MAC) protocol is presented for next generation OFDMA-PONs. The end-to-end delay and network throughput are investigated in the presence of class-of-service and ...