Browsing Research publications by Title
Now showing items 17013-17032 of 22990
-
Pulse current treatment effect on the strength of reinforcing steel and its weld joint under impact loading
(2009)We present results of static and impact tension tests of as-received reinforcing steel specimens, specimens with weld joints in their test portion, as well as specimens pretreated by high-density pulse current. As test ... -
Pulse electric current effect on mechanical properties of titanium aluminide produced by the self-propagating high-temperature synthesis technique
(2012)We present results of study on the effect of pulse electric current treatment on bending strength and hardness of intermetallic titanium aluminide produced by the self-propagating high-temperature synthesis technique. It ... -
Pulse shaping for laser fusion
(1977) -
Pulse stretching and spectroscopy of subnanosecond optical pulses using a Fabry-Perot interferometer
(1977-04)A Fabry-Perot interferometer has been used to produce optical pulses of variable width from a short gaussian input pulse. Pulse stretching of two to five or more times the original pulse width is possible provided a longer ... -
A Purchase Protocol with Live Cardholder Authentication for Online Credit Card Payment
(Institute of Electrical and Electronics Engineers (IEEE), 2008) -
A Purchase Protocol with Multichannel Authentication
(2009)While online shopping are becoming more accepted by people in modern life, cardholders are more concerned about card fraud and the lack of cardholder authentication in the current online credit card payment. This paper ... -
The purification of poly(a)-containing RNA by affinity chromatography
(Springer Nature, 1985)The vast majority of eukaryotic mRNA molecules contain tracts of poly(adenylic) acid, up to 250 bases in length, at the 3' end. This property is very useful from the point of view of mRNA extraction because it forms the ... -
Purification of RNA
(Wiley-Blackwell, 1992) -
Purification, characterisation and identification of acidocin LCHV, an antimicrobial peptide produced by Lactobacillus acidophilus n.v. Er 317/402 strain Narine
(2010)In the last two decades, antimicrobial peptides (AMPs) have been gaining attention as antimicrobial alternatives to chemical food preservatives and commonly used antibiotics. Lactobacillus acidophilus n.v. Er 317/402 strain ... -
Purinergic 2X receptors mediate endothelial dependent vasodilation to ATP
(2007-11)ATP is an important endogenous mediator in the cardiovascular system. It induces endothelium dependent vasodilation, but the precise receptor pathway activated in this response is currently under debate. We have used ... -
Purinergic contribution to small intestinal afferent hypersensitivity in a murine model of post infectious bowel disease.
(2009-06)Increased sensitivity of the afferent innervation of the gastrointestinal tract reportedly underlies symptoms of discomfort and pain in functional bowel disorders. The present investigation aimed to examine whether the ... -
Puritanism and Truthfulness in Iris Murdoch's Ethics
(Tennessee University Press, 2014-11)In what follows I want to suggest, and to some extent argue, that Iris Murdoch’s understanding of puritanism is central to her ethic and that it constrains, or gives shape to, her account of truthfulness. But this does not ... -
Purple dwarfs : New L subdwarfs from UKIDSS and SDSS
(EDP Sciences, 2013)The first L subdwarf was a discovered only ten years ago. Less than ten L subdwarfs been published in the literature to date. Metal-poor ultracool atmospheres has not been well understood. Halo mass function cross substellar ... -
A Purple Passion? : Queen's College Oxford and the Blood of the Lord
(2012)The Queen’s College Oxford was founded in 1341 ‘under the name of the Hall of the Queen’s scholars of Oxford’ by the endowment of Robert de Eglesfield. The queen in question was Queen Philippa of Hainault, consort of King ... -
The pursuit of relevance in interaction and networks research
(University of Bath, 2000)The paper investigates the perceptions of researchers working in interaction and networks research concerning the relevance of academic research in the field to practical management decision-making. Managerial relevance ... -
Pushforwards via scattering equations with applications to positive geometries
(2022-10-03)In this paper we explore and expand the connection between two modern descriptions of scattering amplitudes, the CHY formalism and the framework of positive geometries, facilitated by the scattering equations. For theories ... -
Pushing the limits: palynological investigations at the margin of the Greenland Ice Sheet in the Norse Western Settlement
(2019-10-17)This paper presents two high-resolution pollen records dating to ~AD 1000-1400 that reveal the impacts of Norse colonists on vegetation and landscape around a remote farmstead in the Western Settlement of Greenland. The ... -
‘Put on your boots and Harrington!’: The ordinariness of 1970s UK punk dress
(2018-06-01)In 2013, the Metropolitan Museum hosted an exhibition of punk-inspired fashion entitled Punk: Chaos to Couture. The exhibition emphasized the ‘spectacular’ elements of the subculture, reflecting a narrative that dominates ... -
Putative DNA quadruplex formation within the human c-kit oncogene
(2005)The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence ...